Sequence Contaminant List

From BioWiki
Jump to: navigation, search

This is a list of contaminants found in high throughput sequencing applications. This could be used to remove or identify potential contaminants.

Illumina Single End Apapter 1 ACACTCTTTCCCTACACGACGCTGTTCCATCT Illumina Single End Apapter 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT Illumina Single End PCR Primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Single End PCR Primer 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT Illumina Single End Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Illumina Paired End Adapter 1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Paired End Adapter 2 CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT Illumina Paried End PCR Primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Paired End PCR Primer 2 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT Illumina Paried End Sequencing Primer 1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Paired End Sequencing Primer 2 CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT

Illumina DpnII expression Adapter 1 ACAGGTTCAGAGTTCTACAGTCCGAC Illumina DpnII expression Adapter 2 CAAGCAGAAGACGGCATACGA Illumina DpnII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina DpnII expression PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina DpnII expression Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina NlaIII expression Adapter 1 ACAGGTTCAGAGTTCTACAGTCCGACATG Illumina NlaIII expression Adapter 2 CAAGCAGAAGACGGCATACGA Illumina NlaIII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina NlaIII expression PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina NlaIII expression Sequencing Primer CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Illumina Small RNA Adapter 1 GTTCAGAGTTCTACAGTCCGACGATC Illumina Small RNA Adapter 2 TCGTATGCCGTCTTCTGCTTGT Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA Illumina Small RNA PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina Small RNA PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina Small RNA Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina Multiplexing Adapter 1 GATCGGAAGAGCACACGTCT Illumina Multiplexing Adapter 2 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Multiplexing PCR Primer 1.01 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Multiplexing PCR Primer 2.01 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT Illumina Multiplexing Read1 Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Multiplexing Index Sequencing Primer GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Illumina Multiplexing Read2 Sequencing Primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

Illumina PCR Primer Index 1 CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC Illumina PCR Primer Index 2 CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC Illumina PCR Primer Index 3 CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTC Illumina PCR Primer Index 4 CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTC Illumina PCR Primer Index 5 CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTC Illumina PCR Primer Index 6 CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTC Illumina PCR Primer Index 7 CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTC Illumina PCR Primer Index 8 CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTC Illumina PCR Primer Index 9 CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTC Illumina PCR Primer Index 10 CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTC Illumina PCR Primer Index 11 CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTC Illumina PCR Primer Index 12 CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC

Illumina DpnII Gex Adapter 1 GATCGTCGGACTGTAGAACTCTGAAC Illumina DpnII Gex Adapter 1.01 ACAGGTTCAGAGTTCTACAGTCCGAC Illumina DpnII Gex Adapter 2 CAAGCAGAAGACGGCATACGA Illumina DpnII Gex Adapter 2.01 TCGTATGCCGTCTTCTGCTTG Illumina DpnII Gex PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina DpnII Gex PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina DpnII Gex Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina NlaIII Gex Adapter 1.01 TCGGACTGTAGAACTCTGAAC Illumina NlaIII Gex Adapter 1.02 ACAGGTTCAGAGTTCTACAGTCCGACATG Illumina NlaIII Gex Adapter 2.01 CAAGCAGAAGACGGCATACGA Illumina NlaIII Gex Adapter 2.02 TCGTATGCCGTCTTCTGCTTG Illumina NlaIII Gex PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina NlaIII Gex PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina NlaIII Gex Sequencing Primer CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA Illumina 5p RNA Adapter GTTCAGAGTTCTACAGTCCGACGATC Illumina RNA Adapter1 TCGTATGCCGTCTTCTGCTTGT

Illumina Small RNA 3p Adapter 1 ATCTCGTATGCCGTCTTCTGCTTG Illumina Small RNA PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina Small RNA PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina Small RNA Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC

ABI Dynabead EcoP Oligo CTGATCTAGAGGTACCGGATCCCAGCAGT ABI Solid3 Adapter A CTGCCCCGGGTTCCTCATTCTCTCAGCAGCATG ABI Solid3 Adapter B CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT ABI Solid3 5' AMP Primer CCACTACGCCTCCGCTTTCCTCTCTATG ABI Solid3 3' AMP Primer CTGCCCCGGGTTCCTCATTCT ABI Solid3 EF1 alpha Sense Primer CATGTGTGTTGAGAGCTTC ABI Solid3 EF1 alpha Antisense Primer GAAAACCAAAGTGGTCCAC ABI Solid3 GAPDH Forward Primer TTAGCACCCCTGGCCAAGG ABI Solid3 GAPDH Reverse Primer CTTACTCCTTGGAGGCCATG